ScopeMed - RSShttp://www.scopemed.orgScopeMed RSSen-us Copyright © 2011 ScopeMed All rights reserved. ScopeMedhttp://www.scopemed.org/img/logo-scopemed-ttk.gifhttp://www.scopemed.org 2015-04-26T04-31-14Z THE CORRELATION BETWEEN BIOFILM FORMATION AND RESISTANCE TO ANTIBIOTICS IN STAPHYLOCOCCAL INFECTIONS http://www.scopemed.org/?mno=186710 2015-04-26T04-31-14Z
Source: THE EGYPTIAN JOURNAL OF EXPERIMENTAL BIOLOGY (Botany)
Hala M. AbuShady Rasha A. Nasr Zeinab E. Hasan Hussein S. Hussein.
Thirty one staphylococci out of 50 were BF forming (according to icaAD gene detection by polymerase chain reaction and/or microtitre plate assay) and 19 non-BF forming isolated from clinical specimens and intravascular catheters of patients admitted to the pediatric hospital of Ain-Shams University. Antibiotic susceptibility testing was performed for all isolates using disk diffusion test for cefoxitin, gentamicin and rifampicin and HiComb MIC Test for vancomycin, erythromycin, ciprofloxacin, sulphamethizole and teracycline. An increase in the resistance of the staphylococcal isolates, particularly the coagulase negative, was noted. No statistical significant difference was detected between BF forming and non BF Staphylococci, however, 48.8% of BF forming strains were methicillin resistant (MR) and all were associated with multiple-resistance to antibiotics as 16% were resistant to 3 antibiotics, 32% to 4 antibiotics, 39% to 5 antibiotics, and 13% to all antibiotics tested. A high resistance was detected MR staphylococcal isolates to erythromycin (92.9%), gentamicin (60.7%), and ciprofloxacin (89.3%) showing a statistical significant difference when compared to methicillin sensitive Staphylococci (63.6%, 9%, 66.7%, respectively). Finally we conclude that there is an increase in the resistance of staphylococcal isolates to different antibiotics and BF formation is associated with multi-resistance to antibiotics.
]]>
Sun, 26 Apr 2015 04:24:40 GMT -08:00 http://www.scopemed.org/?mno=186710
PROPERTIES OF PYOCYANIN PRODUCED BY CARBENCILLIN RESISTANT MUTANTS OF PSEUDOMONAS AERUGINOSA http://www.scopemed.org/?mno=186709 2015-04-26T04-31-14Z
Source: THE EGYPTIAN JOURNAL OF EXPERIMENTAL BIOLOGY (Botany)
Adawia A.H. Al-Saadi May T. Flayyih Asfar S. Al-Shibib.
The aim of the present study was to study the properties and the effects of pyocyanin produced by carbencillin resistant mutants of Pseudomonas aeruginosa against some gram negative and gram positive strains. Three groups of Carbencillin resistant mutants of P. aeruginosa were isolated. Group III of mutants' posses the ability of producing pyocin S. The ability of these mutants to produce pyocyanin was investigated; both mutant groups I and II were found to produce more pyocyanin whereas group III lost its ability to produce pyocyanin. The antibacterial activity of pyocyanin produced by mutants was tested against some gram negative strains (Escherisia coli, Proteus mirabilis), gram positive strain (Staphylococcus aureus), Candida albicans and C. tropicalis; the result showed that the antibacterial activity was increased .The mutants groups also showed different ranges of antibacterial activity as determined by their MICs. Group I was more effective against gram negative strains, Candida albicans and C. tropicalis than wild type Ps7 while group II was more effective against gram positive strains than wild type Ps7.
]]>
Sun, 26 Apr 2015 04:21:12 GMT -08:00 http://www.scopemed.org/?mno=186709
CHEMICAL ANALYSIS AND ANTIFUNGAL ACTIVITY OF PALIURUS SPINA-CHRISTII http://www.scopemed.org/?mno=186707 2015-04-26T04-31-14Z
Source: THE EGYPTIAN JOURNAL OF EXPERIMENTAL BIOLOGY (Botany)
Luma T. Ahmed Nabeel K. Al-Ani Khlood W. Smariee.
Paliurus spina-christii Mill (Christis thorn, Ramnaceae) is a traditional Mediterranean and Asiatic medicinal plant. Quality assessment of Paliurus spina-Christi was done by using a high performance liquid chromatography and gas chromatography. The high performance liquid chromatigraphy analysis of methanolic extract of the stem of this plant showed presence of gallic acid, cafetric acid, syringic acid and epichotichen, while gas chromatography showed a wide range of sugar compounds, phenols ,alkaloids and esters. Antifungal activity of methanol extract was also examined and revealed a clear inhibition zone at 75 µg, 100 µg, 125 µg, against Trichophyton mentagrophytes
]]>
Sun, 26 Apr 2015 04:06:27 GMT -08:00 http://www.scopemed.org/?mno=186707
ASSESSMENT OF AIRBORNE TRACE METAL POLLUTION BY IPOMOEA CARNEA JACQ. LEAVES AND ITS POTENTIAL USE AS ENVIRONMENTAL INDICATOR http://www.scopemed.org/?mno=186705 2015-04-26T04-31-14Z
Source: THE EGYPTIAN JOURNAL OF EXPERIMENTAL BIOLOGY (Botany)
Emad A. Farahat Nasser A. Sewelam Ebrahem M. Eid.
This paper aims to assess the concentration of some trace metals in the leaves of the invasive plant Ipomoea carnea Jacq. at El-Gharbiya and Kafr El-Sheikh Governorates, Egypt, in order to evaluate the suitability of its leaves as bio-monitoring of air pollution. Leaf samples were collected during the main growing season (summer) from four different habitats (road side, cultivated land, waste land and canal bank). Samples were analyzed for Cd, Cu, Mn, Ni, Pb, and Zn using Inductively Coupled Plasma Mass Spectrometry. Results indicated that the metallic elements in the leaves of I. carnea had the following sequence: Mn > Cu > Zn > Ni > Pb > Cd. The spatial variability of trace metals was significant only for Mn, Pb and Zn (at P < 0.05). Cultivated land and canal bank showed insignificant higher metal concentrations in its leaves compared with the road side and waste land habitats (except for Cd and Cu). The concentrations of Ni was positively correlated with the distance from the main motorway (r = 0.65, P < 0.05). All the measured trace metals had wide concentration range between sites. 50% of the sampled sites had high toxic concentration of Pb (from 7.2 to 17.8 ppm) more than the permissible limits recommended by WHO (> 10 ppm). The present results suggest the suitability of using I. carnea as a bio-monitor for trace metal pollution in the Nile Delta
]]>
Sun, 26 Apr 2015 04:03:19 GMT -08:00 http://www.scopemed.org/?mno=186705
CLONING AND EXPRESSION OF PSEUDOAZURIN GENE IN ESCHERICHIA COLI DH5α http://www.scopemed.org/?mno=186704 2015-04-26T04-31-14Z
Source: THE EGYPTIAN JOURNAL OF EXPERIMENTAL BIOLOGY (Botany)
Mahmoud A. Ismail.
Pseudoazurin (PAz) is a blue copper protein that functions as an electron carrier in numerous microorganisms. In several denitrifying bacteria PAz serves as the electron donor to nitrite reductase (NiR) in the anaerobic respiration system. Achromobacter cycloclastes IAM 1013 was grown at 30ºC in LB medium and genomic DNA was isolated (using the GENOME kit from BIOgene). The genomic DNA was used as a template in polymerase chain reactions (PCR) in which the PAz gene was amplified using the following two primers: ccatggtgaatgcaatcaagag (forward primer) and ccatggctagaagtcgcttagt (reverse primer). The primer sequences were based on the DNA sequence of Achromobacter cycloclastes IAM 1013 PAz and were designed in such a way to include the signal sequence for the protein. The amplified fragment was cloned into PET 15b vector which digested with Nco1.Polyacrylamide gel electrophoresis was used to characterize the extracted protein
]]>
Sun, 26 Apr 2015 04:00:51 GMT -08:00 http://www.scopemed.org/?mno=186704
REMOVAL OF ZINC AND COPPER BY MOUGEOTIA SP. IN AQUEOUS SOLUTIONS http://www.scopemed.org/?mno=186703 2015-04-26T04-31-14Z
Source: THE EGYPTIAN JOURNAL OF EXPERIMENTAL BIOLOGY (Botany)
Ithar K. Al-Mayaly Abbas M. Ismai Altaf A. Issa.
Mougeotia sp. is one of the filamentous green algae which have efficiency to remove and tolerate both zinc and copper which gives this alga the ability to use in treatment of the polluted water. Mougeotia sp. was exposed to different concentrations (0.5, 1, 2, 3, and 4 ppm) of zinc and copper separately in order to test its ability to remove these two metals from their solutions. The results revealed that Mougeotia sp. possess high ability to remove zinc and copper by 90.50% and 99%, respectively.
]]>
Sun, 26 Apr 2015 03:53:52 GMT -08:00 http://www.scopemed.org/?mno=186703
STUDIES OF GENETICS CHANGES INDUCED IN SACCHAROMYCES CEREVISIAE BY THREE ANTI-DEPRESSION DRUGS http://www.scopemed.org/?mno=186702 2015-04-26T04-31-14Z
Source: THE EGYPTIAN JOURNAL OF EXPERIMENTAL BIOLOGY (Botany)
Hind AA. Al-Zahrani Ola M.I. El-Hamshary.
In this study the ability of three anti-depression drugs (Risperdal, Cymbalta, and Faverin) to induce genetic changes in Saccharomyces cerevisiae D7 was studied, as well as the effects of these drugs on survival rates of S. cerevisiae D7. The results revealed that the survival percentage of Saccharomyces cerevisiae D7 strain was decreased with increase of concentration and exposure period to anti-depression drugs. On the other hand, the Risperdal, Cymbalta, and Faverin are capable of inducing mitotic gene conversion, reversion, and mitotic crossing over. The high doses of drugs resulted in increasing in the average of cells recombination compared with the control sample. The high concentration of Risperdal (0.012 mg/ml) induced high level of mutagenic activity (2.2) compared with reversion and mitotic crossing over which recorded some repeated values (2.3 & 2.5, respectively) compared with control. According to the two other concentrations (0.002 and 0.006 mg/ml), there was nothing mentioned about the active level of the drug with the control towards the three end points. The high concentration of cymbalta (0.18 mg/ml) induced the high level of mutagenic activity (3.04) compared with reversion and crossing over which indicated some repeated values (2.98 & 3.88, respectively) compared with control, while at concentration of (0.12 mg/ml) induced mutagenic activity, reversion, and crossing over (1.88, 2.47, and 2.41, respectively), compared with control. Faverin was capable of inducing gene conversion, reverse mutation and mitotic crossing over at high concentration (0.4 and 0.3 mg/ml, respectively), in the lowest concentration it did not exceed (0.2 mg/ml) inducing gene conversion, reverse mutation and mitotic crossing over. Therefore, the application of these chemicals should be carried out under certain cases of necessity.
]]>
Sun, 26 Apr 2015 03:51:48 GMT -08:00 http://www.scopemed.org/?mno=186702
GROWTH PROMOTION AND BIOCONTROL OF LEAF SPOT AND LEAF SPECK DISEASES IN TOMATO BY PSEUDOMONAS SPP. http://www.scopemed.org/?mno=186700 2015-04-26T04-31-14Z
Source: THE EGYPTIAN JOURNAL OF EXPERIMENTAL BIOLOGY (Botany)
Mohamed E.A. Dawoud Zienat K. Mahmoud Hanaa E. Ahmed Mohamed G. Farahat.
Thirty five endophytic fluorescent bacteria were isolated from root tissues of healthy tomato plants in Egypt (El-Giza, El-Quliobiya, El-Fayoum and El-Behira Governorates) and tested for their efficiency for inhibiting growth of tomato pathogen, Alternaria solani and Pseudomonas syringae. Two most effective isolates MG4 and MG18 against the three pathogens were selected and identified as Pseudomonas putida and P. fluorescens. Plant growth promoting activity of the two Pseudomonas spp. was evaluated. Both endophytic bacterial species produced siderophore, HCN, ammonia and IAA but IAA production was higher with P. putida which was also able to solubilize phosphate. Tomato roots were subjected to colonization after bacterization with two Pseudomonas species. Treatments with P. putida or P. fluorescens through seedling dip were highly effective in inhibiting leaf spot caused by A. solani and bacterial speck caused by P. syringae but P. fluorescens was more effective than P. putida. The potential of two Pseudomonas spp, for tomato growth promotion was evaluated in green house either individually or in mixtures. They significantly enhanced all growth parameters.
]]>
Sun, 26 Apr 2015 03:48:19 GMT -08:00 http://www.scopemed.org/?mno=186700
BIOSORPTION OF RADIOACTIVE ELEMENTS FROM PHOSPHOGYPSUM BY SACCHAROMYCES CEREVISIAE http://www.scopemed.org/?mno=186699 2015-04-26T04-31-14Z
Source: THE EGYPTIAN JOURNAL OF EXPERIMENTAL BIOLOGY (Botany)
Mohamed G. Battah.
This work aim to partially eliminate the radioactive elements by using Saccharomyces cerevisiae grown in different carbon sources such as maltose, sucrose, starch, lactose, fructose and glucose, the analysis of the Phosphogypsum sample was compared after microbe treatment using different techniques for the variety of elements. It was obvious that Saccharomyces cerevisiae uptake the Uranium and Thorium and Radium contents by decreasing them (extraction) from the original mother sample with all different carbon sources. Many analytical techniques such as IR, XRF, chemical analysis, Geometric analysis, and scanning electron microscope were applied to monitor all the changes in the phosphogypsum samples, as well as the changes in radioactive elements content.
]]>
Sun, 26 Apr 2015 03:45:51 GMT -08:00 http://www.scopemed.org/?mno=186699
PCR CLONING, SEQUENCE AND OVEREXPRESSION OF THE XYLANASE A GENE FROM LOCALLY ISOLATED BACTERIUM, BACILLUS SUBTILIS ATF- 40 http://www.scopemed.org/?mno=186698 2015-04-26T04-31-14Z
Source: THE EGYPTIAN JOURNAL OF EXPERIMENTAL BIOLOGY (Botany)
Atef Mohamed Ibrahim.
A new bacterium, Bacillus subtilis strain-ATF40 was isolated from sadat city soil in Minoufiya governerate, Egypt. B. subtilis ATF-40 was characterized, identified morphologically, and biochemically and its 16s rRNA gene also sequenced and deposited in the GenBank JF312740. Xylanase A gene was cloned, sequenced and deposited in the GenBank JF312741. Xylanase A gene has a complete open reading frame 627 bp, with start codon ATG and stop codon TAA. It was amplified from chromosomal DNA of B. subtilis strain ATF- 40.The PCR product was cloned into pTZ57R/T using E. coli 107 and overexpressed in E. coli L21(DE3) using pMal-c2 vector. The positive clone was screened on xylan agar plates by Congo-red staining method.The pMal-c2 vector has maltose binding protein (MBP) gene with a molecular weight 42 KDa. The molecular weight of the fused protein is about 64.5 KDa, this is in agreement with the molecular weighs of MBP 42 KDa and the xylanase protein 22.5 KDa. The fused protein MBP-xylanase activity was also measured before cleavage with factor Xa protease and it is active.
]]>
Sun, 26 Apr 2015 03:43:50 GMT -08:00 http://www.scopemed.org/?mno=186698
MOLECULAR CLONING, SEQUENCE ANALYSIS AND EXPRESSION OF THE GLYCYL-TRNA SYNTHETASE GENE (GLYS A) FROM BACILLUS SUBTILIS SADATA-73 http://www.scopemed.org/?mno=186697 2015-04-26T04-31-14Z
Source: THE EGYPTIAN JOURNAL OF EXPERIMENTAL BIOLOGY (Botany)
Atef M. Ibrahim.
The glycyl-tRNA synthetase (β-subunit) gene from locally isolated and identified Bacillus subtilis sadata-73 was cloned in lambda ZAP XR genomic library XhoI and EcoRI digest. The complete open reading frame was obtained in two steps, sequenced and submitted in the GenBank under accession number EU056819.The gene for this aminoacyl-tRNA synthetase has an open reading frame of 1479 nucleotides. The supposed amino acid sequence encodes a protein of 492 amino acids with MW = 55,142. The protein sequence has extensive overall identity / similarity with the Bacillus subtilis subtilis 168, the Bacillus amyloliquefaciencs, Bacillus licheniformis ATCC 14580 and Bacillus pumilus glycyl-tRNA synthetases (98%, 98%, 78%, 69%, and 66%, respectively). The enzyme was overexpressed as a fusion protein in E.coli using pMal-c2 expression system containing the T7 RNA polymerase/ promoter. The predicted MW for the MBP gene product is in good harmony with the size of the fusion protein determined by SDS-PAGE (M(r) = 55) and the predicted protein has an isoelectric point 5.08.
]]>
Sun, 26 Apr 2015 03:42:11 GMT -08:00 http://www.scopemed.org/?mno=186697
MICROBIAL COMMUNITIES AND WATER QUALITY OF SOME GROUNDWATER SYSTEMS IN EGYPT http://www.scopemed.org/?mno=186696 2015-04-26T04-31-14Z
Source: THE EGYPTIAN JOURNAL OF EXPERIMENTAL BIOLOGY (Botany)
Naziha M. Hassanein Khaled Z. El-Baghdady Atef K. Farid Tarek A. Tawfik Ayman Y. Ewida.
Groundwater in Egypt is of a vital importance and the contamination of drinking groundwater wells is a common problem in many rural areas. Forty-three different sites were selected from eight rural Governorates (Qena, Sohag, Kalubiya, Menofiya, Sharqiya, Gharbiya, Kafr El-Sheikh and Daqahliya) to carry out this study. Study of the effect of heavy metals; aluminum (Al), manganese (Mn), chromium (Cr), arsenic (As), cadmium (Cd) and lead (Pb) on the growth of fungi and bacteria indicated that fungi were strongly resistant to heavy metals and could survive high metal concentrations than bacteria. Penicillium spp. showed resistance to all tested heavy metals except Cd, while Aspergillus spp. and Geotrichum sp. showed resistance to all. On the other hand, most bacterial isolates were sensitive to Cd, Cr, Pb and As and showed some resistance to Al. Furthermore, Pseudomonas aeruginosa, Bacillus licheniforms, Kurthia gipsonii, and Escherichia coli were the most resistant isolates. Results showed that 96% of bacterial isolates were resistant to one or more of the tested antibiotics. None of the tested isolates showed resistance to ofloxacin. Also, about 58% of the total resistant isolates showed multiple antibiotic resistance (MAR), and Pseudomonas aeruginosa was the most resistant species. On the other hand, the calculated antibiotic resistance index (ARI) for the bacterial isolates collected from the groundwater at Gharbiya did not exceed the high risk level while that of Kafr El-Sheikh, Sohag, Kalubiya, Daqahliya, Menofiya and Qena considered as water of high risk pollution. Some interactions between fungal and bacterial communities were also studied. Results indicated that Chlorination of groundwater affected the count of total coliform and fecal coliform bacteria and about 70% and 90% of fungal and bacterial counts, respectively, were removed. The water quality index (WQI) for the selected areas was also studied. Finally, we recommended that the groundwater quality status of the rural areas must be studied carefully and the mycobiota of water should be considered when the microbiological safety and quality of drinking water are assessed.
]]>
Sun, 26 Apr 2015 03:40:01 GMT -08:00 http://www.scopemed.org/?mno=186696
SCREENING AND EVALUATION OF SOME FUNGAL ENDOPHYTES OF PLANT POTENTIALITY AS LOW-COST ADSORBENTS FOR HEAVY METALS UPTAKE FROM AQUEOUS SOLUTION http://www.scopemed.org/?mno=186694 2015-04-26T04-31-14Z
Source: THE EGYPTIAN JOURNAL OF EXPERIMENTAL BIOLOGY (Botany)
Naziha M. Hassanein Mervat MA. El-Gendy Hussein Abd El-Hay Ibrahim Doaa H. Abd El Baky.
Wastewaters resulted from different industries in Egypt such as food, painting, service, pharmaceuticals, water valves, packing materials (e.g. cartoons) and inks industries which are drained with sewage wastes and underground water which contain different harmful concentrations of the most toxic heavy metals (e.g. copper and cadmium) to humans and wildlife. This study aims to screen, evaluate, and apply endophytic fungal isolates growing in industrial regions and are capable of degrading recalcitrant materials and accumulating heavy metals to decrease the environmental loading, solve the problems of pollution and improve the quality of drinking and irrigated water in industrial regions. Ten endophytic fungi were isolated and screened for uptake experiments. All endophytic fungal isolates under study showed cadmium and copper resistance with varying level. Among them, endophytic Penicillium lilacinum showed the highest potency to remove copper (85.4%) and good removal of cadmium (31.43 %). The Langmuir model was more able to describe the experimental equilibrium data for biosorption of Cd2+ and Cu2+ ions on fungal pellets under given experimental conditions than Freundlich isotherm model. High value of Langmuir constant b (0.121 and 1.54, L/mg) indicates the affinity of biosorption and the binding of metal ions Cu2+ and Cd2+ respectively, resulting in a stable adsorption product.
]]>
Sun, 26 Apr 2015 03:35:58 GMT -08:00 http://www.scopemed.org/?mno=186694
Department of Botany, Faculty of Science, Zagazig University, Egypt http://www.scopemed.org/?mno=186693 2015-04-26T04-31-14Z
Source: THE EGYPTIAN JOURNAL OF EXPERIMENTAL BIOLOGY (Botany)
Mohammad I. Abdel-Hamid Mervat H. Hussein Sherif S. Elshafey.
Water treatment efficiencies of different five treatment plants providing drinking (potable) water to the greater population size of Dakahleia governorate in Egypt were investigated and compared. The selected plants vary widely in hydrology of surface raw water resource, engineering design and certain performance characteristics. All the selected water treatment facilities adopt the conventional water treatment processes that involve the successive treatment stages of coagulation, flocculation and sedimentation (clarification) followed by granular bed filtration. Raw, clarified and filtered water samples were seasonally collected between mid-spring 2008 and mid-winter 2009. The treatment efficiency tools include comparative evaluation of certain physical and chemical characteristics (e.g. turbidity, ammonia-N, BOD and COD) of raw and treated water, removal of suspended algae and water toxicity testing with standard algal biotest. The results indicated substantial reduction in water turbidity of raw water with a mean annual value of 0.6 NTU of the potable water. Significant (P ≤ 0.05) increase in dissolved oxygen coupled with sharp decline of BOD and COD of drinking water were recorded. Potable water was entirely nitrite-N and ammonia-N free. The phytoplankton-based biological indices indicated water quality consequences agreed well with that revealed by the physical and chemical characteristics of raw water. After the clarification stage, the major treatment plants DWTPs 1, 2, and 3 maintained superior removal efficiencies (77.3% - 90.3%) of suspended micro-algae compared with the compact units DWTPs 4 and 5 (63.4% - 82.3%). Except the obvious failure of compact unit DWTP4 that removed only 76.4% of algal biomass of filtered water in spring, all the selected plants removed about 99.9% of algal biomass after filtration stage. In conclusion, the results indicated that, the selected water treatment plants provide drinking water with acceptable quality coping with both WHO and Egyptian guidelines.
]]>
Sun, 26 Apr 2015 03:33:55 GMT -08:00 http://www.scopemed.org/?mno=186693
MOLECULAR AND MICROBIOLOGICAL STUDIES ON VANCOMYCIN RESISTANT STAPHYLOCOCCUS AUREUS (VRSA) STRAINS ISOLATED FROM BURNED PATIENTS http://www.scopemed.org/?mno=186692 2015-04-26T04-31-14Z
Source: THE EGYPTIAN JOURNAL OF EXPERIMENTAL BIOLOGY (Botany)
Wesam A. Hassanein Yehia A. EL-Zawahry Fifi M. Reda Reham A. Abd El-Rahman.
The present investigation covered a total of seventy burned patients, 40 from Sidnawy Hospital, Zagazig University, Egypt, and 30 patients from king Fahd Hospital, Al Qassim, Saudi Arabia. The incidence of total microorganisms isolated from swab, blood, urinary and sputum cultures indicated that Gram-positive bacteria were the most predominant microorganisms representing 72 out of 121 total isolates (59. 50%), while 49 isolates were Gram-negative (40.50%). The most common pathogenic bacterial group isolated from patients was Staphylococcus aureus, followed by K. pneumonia and P. aeruginosa, whereas, S. epidermidis and Micrococcus showed the lowest incidence. The antibiotics sensitivity against fifty seven S. aureus isolates indicated high resistance to ampicillin (63.15 %) and methicillin (71.92%), intermediate to amoxicillin, and high susceptibility to imipenem and vancomycin except that, the four isolates no. 12, 30, 50 and 95 were multiresistant .These isolates were resistant to 11 antibiotics which include imipenem and vancomycin . Identification of the four isolates was confirmed molecularly using 16S rDNA gene sequence. The determined minimum inhibitory concentrations (MICs) of vancomycin antibiotic indicated differences in antibiotic resistance among the four tested S. aureus strains. Multiplex PCR amplification of mecA and vanA genes in tested strains, using specific primers revealed that all tested strains were mecA gene negative, while two out of four tested strains had vanA gene. Also the tested VRSA strains were characterized by their production to virulence factors hemolysins, lecithinases and proteases. Out of nine tested essential plant oils, thyme and tea tree oils were the most potent against the tested VRSA strains. Synergetic effects were obtained in combination treatment between vancomycin with thyme oil or tea tree oil (50 %:50%) against VRSAS strains. Furthermore there was a significant decrease in production of protease, hemolysin and lethinase by the tested bacteria after incubation in the presence of 0.3 and 0.6% tea tree oil for 24 h.
]]>
Sun, 26 Apr 2015 03:26:34 GMT -08:00 http://www.scopemed.org/?mno=186692
Organic Agriculture: The Science and Practices under a Changing Climate http://www.scopemed.org/?mno=186685 2015-04-26T04-31-14Z
Source: Emirates Journal of Food and Agriculture
Abdullah A Jaradat.

]]>
Sun, 26 Apr 2015 02:38:21 GMT -08:00 http://www.scopemed.org/?mno=186685
Effects of subchronic exposure of PSP Ganoderma lucidum on renal function and histopathology feature in Rattus novergicus Wistar strain http://www.scopemed.org/?mno=181788 2015-04-26T04-31-14Z
Source: National Journal of Physiology, Pharmacy and Pharmacology
Titin Andri Wihastuti, Djanggan Sargowo, Mohammad Aris Widodo, Teuku Heriansyah, Setyowati Soeharto, Kenti Wantri Anita, Novita Qurrota A’ini.
Background: Ganoderma lucidum, commonly referred to as Lingzhi in China, is a fungus that has been widely used through the centuries for the general promotion of health and longevity in Asian countries. Aims and Objective: To determine the effects of subchronic exposure of PSP G. lucidum on renal function and renal histopathology feature in Rattus novergicus Wistar strain. Materials and Methods: A total of 80 male and female Wistar rats, aged 2–3 months with a body weight of 200–300 g, were divided into four treatment groups: dose group 0 (control group), group PSP G. lucidum dose of 300, 600, and 1200 mg/kg for 90 days. Parameters measured were urea and creatinine levels and renal histopathology feature. Result: From the research, the highest urea levels were found in the group in which female Wistar rats were treated with PSP dose of 300 mg/kg/day with an average concentration of urea of 33.2 mg/dL, whereas creatinine levels were found to be equally high on treatment with PSP dose of 1200, 600, and 300 mg/kg/day with an average concentration of urea of 0.3 mg/dL. On histopathological examination, no morphological abnormalities were found. The results of one-way analysis of variance test showed no significant difference at all PSP G. lucidum doses. Conclusion: It is concluded that giving PSP G. lucidum in three variant doses does not cause dysfunction and histological damage to the renal function.
]]>
Sun, 26 Apr 2015 00:50:36 GMT -08:00 http://www.scopemed.org/?mno=181788
Evaluation of knowledge and perception toward adverse drug reactions among patients visiting tertiary-care teaching hospital http://www.scopemed.org/?mno=181071 2015-04-26T04-31-14Z
Source: National Journal of Physiology, Pharmacy and Pharmacology
Anuradha Joshi, Nishal Shah, Malkesh Mistry, Alpa Gor.
Background: Adverse drug reactions (ADRs) constitute important cause of morbidity and mortality affecting all age groups. Most of the studies in past have explored and reported knowledge and perception toward ADRs among health-care professionals, pharmacists, and medical students. But studies on awareness among patients are limited. To improve understanding of ADR and its reporting, it is important to find out the same among patients. Objective: To assess knowledge and perception toward ADR among patients visiting tertiary-care rural hospital, and to sensitize patients on ADR reporting system. Materials and Methods: This observational study was conducted at tertiary-care teaching hospital and 150 patients were selected randomly. Demographic details of respondents were noted and questionnaire regarding knowledge and perceptions was given to fill up. Data were analyzed by using descriptive statistics. Result: Demographic analysis showed that 59% patients were men, 56% were from rural areas, and 45% were graduates. Regarding knowledge about ADR, 78.6% patients were aware that medicines can cause ADRs and 33% had experienced side effects in past. None of the respondents were aware of ADR reporting center. Regarding perceptions toward ADR, 86.7% agreed to report ADR in future and 56% respondents believed ADR reporting may strengthen the patient safety. According to 70% patients, awareness campaign is the best way to educate them regarding ADR. Conclusion: Educational interventions are needed to improve awareness among patients regarding importance of ADR reporting.
]]>
Sun, 26 Apr 2015 00:49:54 GMT -08:00 http://www.scopemed.org/?mno=181071
Comparison on perception of teaching aids among medical versus dental students http://www.scopemed.org/?mno=163444 2015-04-26T04-31-14Z
Source: National Journal of Physiology, Pharmacy and Pharmacology
L Florence, L Samananda.
Background: Lecture still remains the most common mode of instruction in higher education. Students learn from lectures by listening, observing, summarizing, and note taking. Lectures can be supplemented with audiovisual aids for better illustrations, clarity, and learning. Aims and Objective: To assess student’s perceptions of the impact of different teaching aids and to analyze the preferences for teaching aids of medical versus dental students. Materials and Methods: Medical and dental undergraduates were asked to fill in 10-item questionnaire about their perceptions on three lecture delivery methods used in our college. The results were analyzed separately for medical and dental students to see any difference in their perceptions. Result: Majority of the medical students (66.05%) preferred PowerPoint (PPT) presentation, whereas 22.21% preferred the use of blackboard (BB) and 11.1% preferred overhead projector transparency (OHPT) for teaching (P < 0.001). Of the dental students, 61.2% preferred PPT presentation, 26.5% preferred BB, and 12.2% preferred OHPT during lectures (P < 0.001). Conclusion: Majority of both the medical and the dental students clearly preferred the use of PPT presentation in lectures over the other two methods. Visual aids such as PPT will motivate the students to learn their subjects, thus making the learning process an enjoyable experience.
]]>
Sun, 26 Apr 2015 00:49:24 GMT -08:00 http://www.scopemed.org/?mno=163444
Recycling cardboard wastes to produce blue oyster mushroom Pleurotus ostreatus in Iraq http://www.scopemed.org/?mno=186222 2015-04-26T04-31-14Z
Source: Emirates Journal of Food and Agriculture
Mustafa Nadhim Owaid, Ahmed Mahali Abed, Burhan Majed Nassar.
This study revealed successful use of industrial wastes to blue oyster mushroom cultivation as an easy method in Iraq. Some characteristics of yield were calculated using four substrates; S1 (100% wheat straw), S2 (100% cardboard), S3 (50% wheat straw and 50% cardboard) and S4 (30% wheat straw and 70% cardboard), using two capacities of bags 30×50 cm and 25×20 cm. The best total yield performance was 136.3 g/bag by S2 in big bags; also, the best significant (P
]]>
Sun, 26 Apr 2015 00:13:43 GMT -08:00 http://www.scopemed.org/?mno=186222
EFFECT OF DIETARY INCLUSION OF SALT ON THE HAEMATOLOGY AND SERUM BIOCHEMISTRY OF TURKEY POULTS http://www.scopemed.org/?mno=185293 2015-04-26T04-31-14Z
Source: International Journal of Livestock Research
Dozie Ndubisi Onunkwo.
This study was conducted to evaluate the effect of graded levels of salt applied through feed and water. Ninety (90) day old turkey poults were used for the study. The design for the experiment was a Completely Randomized Design (CRD). Six diets were formulated with the inclusion of common salt at 0.25, 0.5, 0.75 in T1, T3, and T5 diet on feed while 0.25, 0.5, and 0.75 in T2, T4 and T6 in water. The experiment lasted for 8 weeks. There were significant difference (P
]]>
Sat, 25 Apr 2015 23:42:39 GMT -08:00 http://www.scopemed.org/?mno=185293
PERFORMANCE OF TURKEY POULTS FED DIFFERENT SOURCES OF CALCIUM AND PHOSPHORUS IN THE DIET http://www.scopemed.org/?mno=185212 2015-04-26T04-31-14Z
Source: International Journal of Livestock Research
Dozie Ndubisi Onunkwo.
An experiment was conducted to determine the performance of turkey poults fed different sources of calcium and phosphorus in the diet. Six treatment diets were formulated in which bone meal, oyster shell, Di-calcium phosphate and their combination were included in the diets at 3.0% each. Day old Turkey poults were used for the experiment. Seventy two turkey poults used were randomly allocated to the treatment diets constituting four birds per replicate and twelve per treatments in a completely randomized design treatment. The birds were brooded for the first three weeks while necessary vaccination and medication were applied. The birds were fed and water supplied ad libitum during the study that lasted eight weeks. The final weight of birds fed diet 4 (970g/bird) was significantly higher (p 0.05) from birds fed diets 5 and 6 (900 and 910g/bird). The daily weight gain of birds fed diets 4 (21.43g/bird) was significantly higher (p< 0.05) than that of birds 1 and 6 (17.43 and 17.43g/bird) but was not significantly different (p> 0.05) from that of diets 2. 3 and 5 (18.0, 18.57 and 20.0g/bird). The breast cut-part of turkeys fed diets 1, 2, 3 and 4 (22.39, 25.25, 24.20 and 26.99 percent/bird) were significantly higher (P< 0.05) than that of diet 5 and 6 (23.889 and 23.26). The back cut-part of turkeys fed diet 1 was significantly greater (P< 0.05) than others. The kidney of turkeys fed diet 2 and 3 (1.50 and 1.00%) were not significantly different (P>0.05) but that of diet 2 was differently higher than others. The heart weight of birds fed diet 3 (1.25%) was significantly higher (P
]]>
Sat, 25 Apr 2015 23:38:23 GMT -08:00 http://www.scopemed.org/?mno=185212
COMPARISON OF CORRELATION BETWEEN EGG PRODUCTION TRAITS IN THREE VARIETIES OF HELMETED GUINEA FOWL FROM 28 TO 46 WEEKS OF AGE http://www.scopemed.org/?mno=185294 2015-04-26T04-31-14Z
Source: International Journal of Livestock Research
Ignatius Chijioke Okoro.
This study investigated the egg production performance of three varieties of guinea fowls. The experimental varieties were Pearl (Sake), Lavender (Hurudu) and Black (Angulu). Base populations of 180 guinea fowls were used to generate 144 F1 females comprising 48 birds per variety. Each variety was divided into three randomized replicates containing 16 birds per replicate. Data were collected fortnightly on egg production performance traits. Parameters collected for egg production included body weight (BWT), body weight gain (BWG), feed intake (FI), feed per dozen egg (FDE), feed efficiency (FE), egg number (EN), percent hen day production (% HD). Data collected were subjected to Pearson Product Moment Correlation using SPSS. The result showed that most meat production traits are highly incompatible with egg production characteristics in the helmeted varieties of guinea fowl studied. This was particularly shown in the negative associations between egg numbers and feed efficiency (-0.607, -0.177, and -0.275), percent hen day and feed efficiency (-0.601, -0.320, and -0.362) and body weight gain and egg number (-0.493, -0.148, and -0.433) among others in Pearl, Lavender, and Black respectively. The Pearl and Lavender varieties showed more similarities in their association followed by the Pearl and Black varieties, whereas, the Lavender and Black varieties showed least relationship in their association. The differences that exist among these varieties may be due to non-genetic and/or genetic reasons and suggests the possibility of genetic polymorphisms existing among the egg production traits of helmeted guinea fowls.
]]>
Sat, 25 Apr 2015 23:31:46 GMT -08:00 http://www.scopemed.org/?mno=185294
ANTIBACTERIAL ACTIVITY OF SOME MARINE ALGAL EXTRACTS AGAINST MOST NOSOCOMIAL BACTERIAL INFECTIONS http://www.scopemed.org/?mno=186661 2015-04-26T04-31-14Z
Source: THE EGYPTIAN JOURNAL OF EXPERIMENTAL BIOLOGY (Botany)
Mohamed A. Deyab Mohamed I. Abou-Dobara.
The present study investigated the antibacterial activities of some seaweeds (Ulva lactuca, Laurencia optusa, and Turbinaria triquatra) collected from Red Sea coast-Egypt. Ethanol crude extracts of these macroalgae, as well as their fractions (oleic acid, palmitic acid, fucoxanthin and fucosterol which, extracted from T. triquatra) with five different concentrations were tested against most nosocomial bacteria, such as Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa (Urinary tract infection (UTI), Bacillus cereus, Bacillus subtilis and Staphylococcus aureus (Hospitalized infection) using disc diffusion method. The highest antibacterial activity of crude ethanol extract was observed in T. triquatra (brown seaweed) followed by L. optusa (red seaweed) whereas, green seaweed (U. lactuca) showed less antibacterial activity. All the seaweeds crude extracts and their fractions have shown moderate antibacterial activity
]]>
Sat, 25 Apr 2015 13:09:46 GMT -08:00 http://www.scopemed.org/?mno=186661
ROLE OF CALCIUM IN ALLEVIATION OF COPPER TOXICITY IN GLYCINE MAX L. (SOYBEAN) SEEDLINGS http://www.scopemed.org/?mno=186660 2015-04-26T04-31-14Z
Source: THE EGYPTIAN JOURNAL OF EXPERIMENTAL BIOLOGY (Botany)
Hanan M. Abou-Zeid Salwa A. Abdel-Latif.
The supplementation of Cu- contaminated nutrient solution with 40- 400 mg L-1 of soybean (Glycine max L.) seedlings with 5 mM CaCl2 was studied. Excess Cu2+ caused a significant decrease of growth parameters, photosynthetic pigments (Chl.a, Chl.b, and carotenoids), and Ca2+ concentration in shoots and roots, while enhanced the Cu2+ accumulation. Furthermore, Cu2+ increased the production of ROS, lipid peroxidation as indicated by increase of malondialdhyde (MDA) content, as well as antioxidant enzyme superoxide dismutase and peroxidase (SOD, POD) activities. Excess Cu2+ depressed catalase (CAT) activity in soybean plants. Application of Ca2+ alleviated the inhibitory effect of Cu2+ on growth and oxidative damages as evidenced by lowering hydrogen peroxide (H2O2) and (MDA) contents. Moreover addition of Ca2+ resulted in a significant increase of CAT and POD activities in Cu-stressed soybean seedlings. The results of this study indicated that Ca2+ shift to some extent, the toxic effects of Cu2+ on soybean growth.
]]>
Sat, 25 Apr 2015 13:05:34 GMT -08:00 http://www.scopemed.org/?mno=186660
BIOSORPTION OF CADMIUM AND CHROMIUM BY CURVULARIA PALLESCENCE http://www.scopemed.org/?mno=186659 2015-04-26T04-31-14Z
Source: THE EGYPTIAN JOURNAL OF EXPERIMENTAL BIOLOGY (Botany)
Mohamed A. Hefnawy Hadeel S. Elshall.
Cadmium and chromium adsorption by fresh and dried biomasses of Curvularia pallescence were investigated. The biosorption conditions, such as pH, temperature, contact time, initial metal concentration, and biomass bulk density were studied. The optimum pH values for cadmium uptake by fresh and dried biomass were 8.0 and 5.0, respectively. While, the optimum pH values for chromium uptake by fresh and dried biomass were 4.0 and 5.0, respectively. The optimum temperature for maximum metal uptake was found to be at 30˚C. Maximum cadmium and chromium binding capacity by fresh and dried biomass was obtained at concentrations 50 and 200 mgL-1, respectively. The best adsorption capacity of cadmium was obtained at 60 min. contact time. While for chromium it was obtained at 90 min. The binding capacity was decreased with increasing the biomass bulk density. The best binding capacity was obtained by using 0.5g fresh biomass and 0.05 g dried biomass using 20 ml of 200 mg/L cadmium or chromium. Treating the fresh mycelium by NaOH increased its binding capacity and therefore the biosorption efficiency whereas, treating with HCl decreased its binding capacity.
]]>
Sat, 25 Apr 2015 13:03:44 GMT -08:00 http://www.scopemed.org/?mno=186659
TOOTHBRUSHES: A POTENTIAL HEALTH RISK http://www.scopemed.org/?mno=186658 2015-04-26T04-31-14Z
Source: THE EGYPTIAN JOURNAL OF EXPERIMENTAL BIOLOGY (Botany)
Eman Kamel Aldigs.
Toothbrushes are the common oral hygiene device used to enhance oral health as a result of microbial contamination and possible transmission of infectious diseases. A novel toothbrush becomes contaminated with pathogenic bacteria, viruses, and fungi within days of use, which remain viable for different periods of times. The present work aimed to assess the extent of microbial contamination of toothbrushes following use and to investigate the most appropriate time period for their replacement. Sixty participants were divided into five groups to represent different time periods and a control group. Each individual was supplied with a new standardized toothbrush. They were asked to apply selected measures in storage and handling. Toothbrushes were assessed microbiologically to determine the level of contamination at different time intervals. Data collected from the questionnaires and laboratory results were analyzed to assess contamination and cross-contamination. Bacterial growth on tested toothbrushes was 86%, while fungi accounted for 41.7%. A higher number of bacteria were isolated from toothbrushes before implementing instructions. The number of viable organisms found on toothbrushes and oral swabs were decreased after implementing use and storage instructions. The results indicated that new guidelines in use and storage conditions of toothbrushes can assist in avoiding microbial contamination. Believing in “Prevent the preventable”, guidelines should be identified, regarding toothbrush replacement especially for immunocompromised patients. Patients with systemic, localized, or oral inflammatory diseases should be educated to change their toothbrushes after recovery.
]]>
Sat, 25 Apr 2015 13:01:57 GMT -08:00 http://www.scopemed.org/?mno=186658
PURIFICATION AND CHARACTERIZATION OF EXOPOLYSACCHARIDES (EPS) EXTRACTED FROM SACCHAROMYCES CEREVISIAE http://www.scopemed.org/?mno=186657 2015-04-26T04-31-14Z
Source: THE EGYPTIAN JOURNAL OF EXPERIMENTAL BIOLOGY (Botany)
Hanan M. Mubarak Saida M. Amer.
Extracellular-polysaccharide EPS was extracted from Saccharomyces cerevisiae growth medium after 10 days from incubation at 25oC and pH 7 on liquid Subaroud's medium. The extracted Saccharomyces cerevisiae EPS (ScEPS) was purified using gel filtration chromatography on a sephadex G – 100 column. The extracted EPS was found to have a maximum relative viscosity in water (3.43 dl/g) and maximum specific viscosity (2.43 dl /g), while the intrinsic viscosity recorded 1.38 dl /g for S. cerevisiae EPS solutions. The chemical analysis of the extracted polysaccharide was found to contain the following constituents, total carbohydrates 61.79%, uronic acids 28%, conjugated protein 4.8%, hexosamines 0.18%, acetyl groups 0.6%, pyruvate groups 0.35%, phosphate groups 1.4%, sulphate groups and an anionic density equal 0.43 mg alcian blue fixed per mg EPS dry weight. The extracted exopolysaccharides also show the following functional groups under IR spectra (hydroxyl, alkanes, sulphydryls alkenes, carbonyl, methyl, carbonyl of carboxylic acid, phosphates, and sulphates). HPLC analysis for the hydrolyzed ScEPS revealed that the monosaccharide composition of the EPS was as follow arabinose, ribose, galactose, glucose, xylose, rhamanose, mannose, glucuronic acid, galacturonic acid, and unidentified sugar with the following ratios 6.683, 2.934, 1.793, 1.694, 1.943, 1.953, 0.980, 4.298, and 2.697. In addition, NMR analysis for the extracted ScPS showed that the chemical shifts of 13 C from EPS polymer under NMR spectra showed one signal at δ 20 ppm, δ 55 ppm, δ 60 ppm, δ 170 ppm and δ 175 ppm in addition to 8 signals at the range from δ 65 to 85 ppm referring to different chemical groups on the sugars of the polysaccharide.
]]>
Sat, 25 Apr 2015 12:59:51 GMT -08:00 http://www.scopemed.org/?mno=186657
PETIOLAR VASCULARIZTION OF SIMPLE, LOBED AND COMPOUND LEAVES IN CERTAIN TAXA OF THE ARALIACEAE AND ITS TAXONOMIC IMPLICATIONS http://www.scopemed.org/?mno=186656 2015-04-26T04-31-14Z
Source: THE EGYPTIAN JOURNAL OF EXPERIMENTAL BIOLOGY (Botany)
Magdy Mohamed Mourad.
The vascular anatomy of petioles and petiolules of ten species of Araliaceae represents all the leaf forms, from simple to compound were studied. The vascular anatomy of compound leaves petioles was shoot-like vascular elements. The characters obtained were analyzed by the NTSYS-pc program package, using the UPGMA clustering method. The produced dendrogram showed an independent separation of simple leaf (Meryta denhamii) from lobed and compound leaves. Lobed leaf species (Hedera helix and Tetrapanax papyrifer) are early separated from the compound leaf taxa. All the compound leaf taxa (Polyscias fruticosa, P. guilfoylei, P. scutellaria, Schefflera actinophylla, S. arboricola and Sciadophyllum pulchrum) were clustered together. The lobed leaf could be considered as a type of compound forms. Compound leaves seem to have an independent origin from an ancestrally simple state.
]]>
Sat, 25 Apr 2015 12:57:11 GMT -08:00 http://www.scopemed.org/?mno=186656
THE PREVALENCE OF CANDIDA SPECIES AMONG CATHETERIZED URINE PATIENTS IN RAMADI HOSPITAL http://www.scopemed.org/?mno=186655 2015-04-26T04-31-14Z
Source: THE EGYPTIAN JOURNAL OF EXPERIMENTAL BIOLOGY (Botany)
Zainab Kh. Abaas Waleed Ismial Ahmid Al-Obidi.
A Catheter-associated candidiasis infection is the most common nosocomial infection and the objective of this work is to study the isolation and identification of Candida species from catheterized urine specimens among male and female patients. One hundred and thirty five catheterized urine samples were obtained from out and in patients, attending Ramadi general and teaching Hospital clinic during the period October 2011 to April 2012. A quantitative urine culture was used for isolation and identification of Candida species on selective media with antibiotics as Sabouraud Dextrose Agar. The identification of Candida species is based upon a combination of morphological and biochemical criteria as germ tube test and API 20 candida. Out of the one hundred and thirty five catheterized urine specimens from male and female patients were examined. Candida spp. was isolated from 92 patients, among the 52 female and 40 male patients. The isolated Candida spp. were 26 (40.0%) C. albicans among female patients and 20 (36.4%) among male patients. Different age groups conducted in these work ranging from 20-89 years old and classified into seven age groups. Out of the 92 male and female who had candidiasis 21 (22.8%); 10 (10.8%) were diabetic patients among female and male, and 59 (64.1%), 28 (30.4%) were using antibiotic among female and male. Chi–square test was used in the present work for statistical analysis. The work suggested that candidiasis is the most common nosocomial infection among patients with catheter.
]]>
Sat, 25 Apr 2015 12:54:41 GMT -08:00 http://www.scopemed.org/?mno=186655
SENSITIVITY OF URINARY TRACT INFECTING BACTERIA TO CERTAIN ANTIBIOTICS http://www.scopemed.org/?mno=186653 2015-04-26T04-31-14Z
Source: THE EGYPTIAN JOURNAL OF EXPERIMENTAL BIOLOGY (Botany)
Mahmoud Abd El-Mongy Ahmed M. Reyad.
The present work aimed to study the current situation of antibiotic resistance of human pathogens caused Urinary tract infection (UTI). 100 urine samples were collected from patients ranging the age from 5 to 70 years. Bacterial pathogens were isolated and identified following the definition of the National Committee of Clinical Laboratory Standards. The obtained results showed that Escherichia coli was the predominant pathogen (48%) causing UTI, followed by Klebsiella pneumoniae (19%), Pseudomonas aeruginosa (6%), Proteus mirables (6%), Enterobacter cloacae (4%), Enterococcus faecalis (4%), Citrobacter koseri (2%), Staphylococcus aureus (1%), Acintobacter beun (1%), Staphylococcus sciuri (1%), Serratia marcescens (1%) and negative samples (5%). Strains isolated from urinary tract infections were examined for susceptibility to antibiotics, few of antibiotics were effective and most of pathogens were resistant and were grouped as multidrug resistant (MDR) strains. Among this E. coli, K. pneumoniae and P. aeruginosa were highly resistant to the antibiotics, whereas Staphylococus and Serratia marcescens exhibited high sensitivity to cefoxitin, cefepime and aztreonam. The present study evaluated the prevalence of bacteria implicated in UTI and indicated the emerging of multidrug resistance among the isolated bacterial pathogens.
]]>
Sat, 25 Apr 2015 12:35:04 GMT -08:00 http://www.scopemed.org/?mno=186653
PROTECTIVE ROLE OF SELENIUM IN CANOLA (BRASSICA NAPUS L.) PLANT SUBJECTED TO SALT STRESS http://www.scopemed.org/?mno=186652 2015-04-26T04-31-14Z
Source: THE EGYPTIAN JOURNAL OF EXPERIMENTAL BIOLOGY (Botany)
Hanan A. Hashem Raifa A. Hassanein Mohamed A. Bekheta Fatma A. El-Kady.
The possible protective effect of selenium (Se) on canola plants (Brassica napus L.) subjected to salt stress was studied by investigating plant growth, yield and changes in photosynthetic pigments, carbohydrate, proline, certain mineral ions content, activities of some antioxidant enzymes of canola plants and fatty acid composition of the yielded seeds. For this purpose canola plants were irrigated with different levels of saline solution (0, 2000, 4000, and 6000 mg L-1, prepared according to Stroganov equation, 1962), then the effect of different dosage of Se (0, 2.5, 5, or 10 mg L-1 selenium as sodium selenate) were examined as foliar spray on 50 and 65 – days old plants. Then samples were collected for analysis as 72 – days old plants. Salinity led to significant inhibition in plant growth, yield components, photosynthetic pigment contents, quantity and quality of seed oil. The detected inhibition was directly related to the applied concentrations of salt. Se applied alone or in combination with salt treatment significantly increased plant growth, yield, photosynthetic pigment content and improved the quality of canola oil. The most effective concentration of Se was 5 mg L-1. In addition, Se-treated plants exhibited various defense mechanisms to cope with salt stress including increased endogenous proline content, enhanced catalase activity and increased magnesium and phosphorus ion contents.
]]>
Sat, 25 Apr 2015 12:33:31 GMT -08:00 http://www.scopemed.org/?mno=186652
IN VITRO SCREENING OF THREE IRAQI WHEAT (TRITICUM AESTIVUM L.) GENOTYPES FOR SALT TOLERANCE http://www.scopemed.org/?mno=186651 2015-04-26T04-31-14Z
Source: THE EGYPTIAN JOURNAL OF EXPERIMENTAL BIOLOGY (Botany)
Zaineb S. Omran Hussam S. Muhammed Amaal S. Abd Al-Sahib Kadhimm M. Ibrahim.
Three wheat genotypes (Triticum aestivum L.) namely Hashimia, Latifia and Tamooz were assessed for their salt tolerance in vitro. Calli were initiated on Murashige and Skoog (1962) basal medium supplemented with Kinetin 0.1 mg/l and 2,4-Dichlorophenoxyacetic acid (2,4-D) 1.0 mg/l using mature embryos as explants. One month old calli were inoculated onto a solid medium salinized with different concentrations of saline water obtained from drainage canals, Missan district, Iraq to make final concentrations of 0, 5, 7.5, 10, 12.5, 15, 17.5, and 20 ds.m-1. Results revealed that the three genotypes of wheat performed very well after subjection to screening and selection for salt tolerance program. The genotype Latifia seems gained more callus fresh weight and responded better than the others. Thus, it is a promising genotype for selection. This study also conducted a molecular marker – based genetic analysis for the three genotypes expressing salt tolerance. The objective was to find molecular markers closely linked to the resistant genes that may be useful for gene cloning and improving salt tolerance in wheat breeding programs. To generate RAPD pattern, 8 primers were used to identify those that would be suitable for this purpose. Four primers showed clear amplification which was completely monomorphic bands. The DNA amplification pattern for Tamooz callus cultured on a medium salinized with 12.5 ds.m-1 exhibited genetic changes by using OPB7 primer.
]]>
Sat, 25 Apr 2015 12:31:43 GMT -08:00 http://www.scopemed.org/?mno=186651
ANTIBACTERIAL ACTIVITY OF NOCARDIOPSIS DASSONVILLEI YSCL2334 AGAINST TENACIBACULUM MARITIMUM ISOLATED FROM DISEASED FISHES IN MARINE AQUACULTURE http://www.scopemed.org/?mno=186650 2015-04-26T04-31-14Z
Source: THE EGYPTIAN JOURNAL OF EXPERIMENTAL BIOLOGY (Botany)
Ahmed Mohamed Reyad Houssam Mohamed Atta Hesham Abdo Mahran.
The aim of the present study was to isolate and identify marine actinomycetes to be used as probiotics having antibacterial activities. The actinomycete isolate YSCl2334 was isolated from Salwa beach in Jazan province, KSA. The isolate was screened for its potential to generate antimicrobial activity against the marine fish pathogens Tenacibaculum maritimum, Vibrio alginolyticus. The actinomycetes isolate YSCl2334 showed high antimicrobial activity against T. maritimum and no antimicrobial activity was observed against Vibrio alginolyticus. Also, the isolate YSCl2334 inhibited the growth of Gram-positive bacteria such Bacillus subtilis and Staphylococcus aureus and Gram-negative bacteria like Escherichia coli and Pseudomonas aeruginosa. The isolate did not show any activity against filamentous fungi like Aspergillus niger or A. flavus, although a strong antimicrobial activity was observed against unicellular fungi Candida albicans. The culture and physiological characteristics tests identified the actinomycetes isolate YSCl2334 as a member of the genus Nocardiopsis. The nucleotide sequence of the 16S rRNA gene (1.272 kb) of the identified isolate proved a 94% similarity with Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111.
]]>
Sat, 25 Apr 2015 12:29:50 GMT -08:00 http://www.scopemed.org/?mno=186650
ABDOMINOCENTESIS WITH TUBE CYSTOTOMY IN A BUFFALO BULLOCK http://www.scopemed.org/?mno=184105 2015-04-26T04-31-14Z
Source: International Journal of Livestock Research
Md Osamah Kalim, Rukmani Dewangan, Shailendra Kumar Tiwari, Sandeep Kumar Singh.
A ten year old male castrated buffalo was brought to the Department of Veterinary Surgery and Radiology with the complaint of anorexia, anuria and pot bellied appearance since 5 days. On clinical examination, dehydration, sunken eye balls and loss of orbital fat were noticed. Exploratory puncture of abdomen showed oozing of straw coloured fluid. Laboratory findings showed elevated PCV (50%), BUN (40 mg/dl) and creatinine (3 mg/dl) values. The temperature and heart rates were normal. Case was diagnosed as rupure of urinary bladder and tube cystotomy was performed to safeguard the life of the animal. Posterior left flank was prepared aseptically and 2% Lignocaine HCl was infiltrated locally around site of skin wound. Ampicillin Cloxacillin (4g) was given prior to surgery. Urinary bladder was exteriorized with gentle manipulation after laparotomy .Rupture of bladder was on its ventral part which was fixed with urinary catheter along with lembert suture using chromic catgut no 1-0. Abdominal wound was closed using 4 layer standard closing technique. Another end of catheter was snugly fitted on preputial skin to prevent loosening of it and making flow of urine. Post operatively Injection Ampicillin Cloxacillin (4g) for 5 days, Injection Meloxicam for 4 days and Cystone tablet 10 tab b.i.d. for 15 days along with antiseptic dressing of surgical wound by Topicure Spray and Povidone iodine ointment were done. Skin sutures were removed on 10th post surgical day and catheter from urinary bladder was removed on 15th post operative day. The animal showed uneventful recovery.
]]>
Sat, 25 Apr 2015 12:28:05 GMT -08:00 http://www.scopemed.org/?mno=184105
EVALUATION OF MAJOR METABOLITES OF TRITICUM AESTIVUM ORGANS IN RELATION TO GRAIN QUALITY IN THE DIFFERENT CULTIVATED PLANT VARIETIES AT THE NILE DELTA, EGYPT http://www.scopemed.org/?mno=186649 2015-04-26T04-31-14Z
Source: THE EGYPTIAN JOURNAL OF EXPERIMENTAL BIOLOGY (Botany)
Mahmoud A. Abdel-Elhaak Mohamed A. Zayed Mohamed A. Elgamal.
This study was conducted to evaluate the content of the major metabolites in the different organs of Triticum aestivum and their relation to grain quality indices. The contents of crude carbohydrate, fibre, lipid and protein did not vary significantly by the Nile Delta parts or plant varieties. In addition, there was increase in carbohydrates, fibres, lipids and proteins of plant organs in north, middle, north and north Nile Delta parts, respectively indicating increase in the plant grain quality in the northern parts. The crude proteins content in the grains was nearly similar to the crude carbohydrates content but it was four times the crude lipids content and thirteen times the crude fibres content. Also, the crude carbohydrates content was more than three times the crude lipids content in T. aestivum grains regardless of the Nile Delta parts, locations and plant varieties. The contents of each crude carbohydrates, lipids and proteins were in grains > leaves > stems > roots of T. aestivum. Opposite trend was observed for T. aestivum crude fibres (roots > stems > leaves > grains). The indices of grain quality (proteins/carbohydrates index, proteins/lipids index and carbohydrates/lipids index) showed that T. aestivum varieties have nearly similar quality as indicated by the not significant variations in the grain quality by Nile Delta parts or locations of the same part. Masr 1 variety had slightly high proteins/carbohydrates index and moderate proteins/lipids index and least carbohydrates/lipids index indicating good quality of the plant grains in comparison with the other cultivated varieties.
]]>
Sat, 25 Apr 2015 12:27:55 GMT -08:00 http://www.scopemed.org/?mno=186649
APPLICATION OF PLACKETT-BURMAN EXPERIMENTAL DESIGN FOR LIPASE PRODUCTION BY A NOVEL ISOLATE OF PSEUDOMONAS FLUORESCENS UTILIZING OLIVE MILL WASTE WATER http://www.scopemed.org/?mno=186648 2015-04-26T04-31-14Z
Source: THE EGYPTIAN JOURNAL OF EXPERIMENTAL BIOLOGY (Botany)
Youssef M. Abdel Mawgoud Mohamed E.A. Dawoud.
Plackett-Burman design (PBD) was used to efficiently select important medium components affecting the lipase production by a novel Pseudomonas fluorescens isolate utilizing olive mill waste water (OMWW) as the main substrate. Eleven medium components (glucose, olive oil, Tween-80, peptone, yeast extract, sucrose, (NH4)2SO4, NaNO3, Na2HPO4, CaCl2, and MgSO4) were analyzed in twelve experimental trials using PBD. The most significant six components affecting lipase production were found to be olive oil, Tween-80, sucrose, (NH4)2SO4, Na2HPO4, and MgSO4 at p < 0.05. They were found to be contributing positively to the overall lipase production with a maximum production of 0.651 U/ml. Thus, the statistical approach employed in this study allows for rapid identification of important medium parameters affecting the lipase production and the results indicate the efficiency of using PBD for screening processes. However, optimal concentration of the significant components can be determined by further statistical analysis.
]]>
Sat, 25 Apr 2015 12:26:08 GMT -08:00 http://www.scopemed.org/?mno=186648
OIL AND FATTY ACID COMPOSITION OF SPIROGYRA AND CHARA SPECIES FROM BEASTAN SWR SPRING WATER IN SULAIMANI-KURDISTAN REGION OF IRAQ http://www.scopemed.org/?mno=186647 2015-04-26T04-31-14Z
Source: THE EGYPTIAN JOURNAL OF EXPERIMENTAL BIOLOGY (Botany)
Farkha K. Trifa Fattah A. Othman Attar T. Omer.
In the present study two genera of green macroalgae, Spirogyra sp. and Chara sp. were collected from freshwater of Beastan swr spring in October 2011. The physico-Chemical parameters of water measured were temperature, pH, conductivity, turbidity, alkalinity, nitrate, phosphate, and sulphate. Oil was extracted from dried algae samples using hexane and petroleum ether as solvents. The percentages of oil extracted were 3.75% and 1.06% from Chara sp., respectively, while 0.69% and 4.24%of oil were extracted from Spirogyra sp., respectively. The most abundant fatty acids were arachidic acid, erucic acid, and docosadienoic acid which determined by HPLC –Technique .The ratio of arachidic acid C20: 4, erucic C22: 1, and docosadienoic C: 22:2 were recorded as 66.03 µg/ml, 94.36 µg/ml and 93.45 µg/ml, respectively from Chara sp. while 89.97 µg/ml of arachidic acid 190.86 µg/ml of erucic acid and 101.28 µg/ml of docosadienoic acid from Spirogyra sp.
]]>
Sat, 25 Apr 2015 12:21:46 GMT -08:00 http://www.scopemed.org/?mno=186647
EVIDENCE FOR GENOTYPING SIMILARITY BETWEEN HELICOBACTER PYLORI STRAINS ISOLATED FROM DENTAL PLAQUE AND PEPTIC ULCER http://www.scopemed.org/?mno=186646 2015-04-26T04-31-14Z
Source: THE EGYPTIAN JOURNAL OF EXPERIMENTAL BIOLOGY (Botany)
El-Baghdady K. Zakaria Abd El-Ghany M. Gad Abdel-Ghafar H. Abdel Aziz Abou-Zeid, M. Abd El-Montaser Abd El-Salam M. Mahmoud.
In this study, genotypes of Helicobacter pylori (H. pylori) strains isolated from dental plaque specimens and peptic ulcer biopsies of the same patient were compared. Gastric biopsies of 30 patients out of 64 cases suffering from gastric ulcer (46.88%) were H. pylori positive. H. pylori was isolated from 4 dental plaque specimens (6.65%) of the number of patients examined. Amplification of UreC gene confirmed that the 34 isolates were H. pylori. All isolates of H. pylori were phenotypically identical. Partial sequence of 16S rRNA gene for H. pylori isolates from dental plaque (HK1D and HK2D) and peptic ulcer biopsies (HK1B and HK2B) of two patients were identical with 99% to H. pylori B38 reference isolate. A single nucleotide substitution (T instead of C) was detected. Whereas, nucleotide sequence analysis of H. pylori isolates from a third patient (HK3B, HK3D) was 100% identical to H. pylori G27 reference strain.
]]>
Sat, 25 Apr 2015 12:20:03 GMT -08:00 http://www.scopemed.org/?mno=186646
TOLERANCE OF BACTERIA TO THE TOXIC OXYANIONS OF ARSENIC AND LEAD IN EASTERN REGION OF THE NILE VALLEY AT BENI-SUEF, EGYPT http://www.scopemed.org/?mno=186645 2015-04-26T04-31-14Z
Source: THE EGYPTIAN JOURNAL OF EXPERIMENTAL BIOLOGY (Botany)
Eman Afkar Salma I. Salah.
This survey focusing on the identification and characterization of the bacteria inhabiting the arsenic (As) and lead (Pb) contaminated regions near the industrial zone of the eastern coast of the Nile valley at Beni-Suef, Egypt. The preliminary results showed that the Arsenic and Lead recorded high levels of contamination (ranging from 4.88-68.8 mg/kg of dry soil for arsenic and 13.6-242.12 mg/kg of dry soil for Lead near the cement and plastic factories located at the eastern part of the Nile valley at Beni-Suef, Egypt. Forty four different bacterial species showing different abilities were isolated to utilize the toxic oxyanions of arsenic and lead as energy source to support growth. Thirty eight bacterial species were able to withstand lead toxicity ranging from 3-10 mg/l. interestingly, six isolates out of the 44 bacterial isolates able to respire the toxic oxyanions of arsenic up to 6 mM; one species belongs to gram-negative bacteria and five species belongs to gram positive bacteria. They were able to reduce arsenate to arsenite in the presence of oxygen; word arsenic can serve as an alternative terminal electron acceptor for their respiratory metabolism. Most of the studied isolates grew optimally at temperature range between 28 and 30ºC and pH 7.0.
]]>
Sat, 25 Apr 2015 12:18:16 GMT -08:00 http://www.scopemed.org/?mno=186645
IN VITRO CYTOTOXIC AND ANTIOXIDANT ACTIVITIES OF SOME PLANT EXTRACTS ON DIFFERENT HUMAN CANCER CELL LINES http://www.scopemed.org/?mno=186644 2015-04-26T04-31-14Z
Source: THE EGYPTIAN JOURNAL OF EXPERIMENTAL BIOLOGY (Botany)
Noha S. Khalifa Salwa M. El-Hallouty Hoda S. Barakat Dina M. Salim.
The present study was conducted to evaluate the in vitro cytotoxic and antioxidant activity of 22 crude extracts from 19 different plant species. Most of plants used were mentioned in ethnomedicine as having potential to treat cancer but they were selected largely due to lack of accurate information about their cytotoxic and /or antioxidants activity. Some of well known edible plants were also used as a reference for the unexplored ones. The cytotoxic and antioxidant activities were tested using the standard [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay (MTT) and 2,2-diphenyl-1-picrylhydrazil (DPPH) test. The in vitro assay for the plant activity was determined using four human cancer cell lines: human liver carcinoma (HepG-2), human lung carcinoma (A549), human colon carcinoma (HT-29) and human breast carcinoma (MCF-7). The cytotoxic and antioxidant status of plants used in this study will be further discussed.
]]>
Sat, 25 Apr 2015 12:15:46 GMT -08:00 http://www.scopemed.org/?mno=186644
EFFECTS OF PACLOBUTRAZOL ON MITIGATION OF TEMPERATURE STRESS INDUCED BY MANIPULATION OF SOWING DATE IN WHEAT PLANT http://www.scopemed.org/?mno=186643 2015-04-26T04-31-14Z
Source: THE EGYPTIAN JOURNAL OF EXPERIMENTAL BIOLOGY (Botany)
Manal Mohamed Emam Hassan S. Abd-Allah Farag A. Abdel-Rrazik.
Paclobutrazol is a trizole fungicide known to have growth retardant properties. This study was conducted to estimate the influences of paclobutrazol (100 mg L-1) on the photosynthetic capacity, as well as the morphological and anatomical features of wheat cv. Sakha 93 sown at different dates, the normal sowing date (november, 26), early sowing date (October,16 ), as well as late one (January, 4). Fluorescence changes appeared to be high-sensitive to chlorophyll decrease before any other visual signs has been observed; the degree of stress was quantified through changes in leaf pigments. The deteriorative symptoms of the early and late sowing indicated by reduction in chlorophyll (a & b) and the increase in fluorescence ratio F680/F730 were ameliorated by paclobutrazol pre-treatment. PBZ pretreatment increased shoot length, stem diameter, leaf area, fresh and dry weights and spike yield of wheat plants at the different sowing dates. The increments of epidermal cell length and width, number of trichomes and crystals (druses), as well as the number of xylem vessels were measured in PBZ-pretreated wheat leaves and stems. Likewise, a concomitant decrease in vessels width and thickness, intercellular spaces and stem pith. The results presumed that PBZ probably contribute to some extent to nullify the damage of the flocculated temperature displayed during different sowing dates thereby enhanced wheat growth and productivity.
]]>
Sat, 25 Apr 2015 12:14:14 GMT -08:00 http://www.scopemed.org/?mno=186643
ANTIBACTERIAL ACTIVITY OF SOME PLANT EXTRACTS ON THE TREATMENT OF SURGICAL WOUNDS INFECTION http://www.scopemed.org/?mno=186642 2015-04-26T04-31-14Z
Source: THE EGYPTIAN JOURNAL OF EXPERIMENTAL BIOLOGY (Botany)
Nagwa Ahmed Abdallah Rafat Zaher Abd El-Rahman Arega Kmal Amer Lamia Ibrahim Morsi Ismaeel.
Twenty two species of bacterial cultures belonging to 8 genera were isolated from infected wound cultures. The most common was Escherichia coli which represented 17.5%, followed by Acinetobacter baumannii 14.5% and come next in rank both of Achromobacter sp. and Pseudomonas aeruginosa which represented 13.5% and 12.6%, respectively. Data also showed that, the occurrence Staphylococcus aureus, Enterobacter aerogenes and Klebsiella pneumoniae representing 11.6%, 4.8%, and 5.8%, respectively. The lowest occurrence was recorded by Morganella morganii that represented 2.9%, while the other remaining isolated species were of rare occurrence frequency. The eight most potent isolates were found to be resistant to the most of tested antibiotics, while they showed variable sensitivity to the tested plant extracts. Methanol extract of cinnamon, guava, sumac, radish, and ether extract of cloves were found to be the most effective plant extracts against the tested pathogenic bacteria isolates. GC/MS analysis of cinnamon oil identified twenty-six phytochemicals as constituents; of these cinnamaldehyde was the major compound (57.6%) followed by Cinnamyl acetate (9.22%), Eugenol (5.070%), Cinnamaldehyde dimethyl Acetal (3.5%), and Vitamin E (2.3%).
]]>
Sat, 25 Apr 2015 12:12:12 GMT -08:00 http://www.scopemed.org/?mno=186642
ROLES OF HYDROGEN SULFIDE AND CYSTEINE IN ALLEVIATION OF NICKEL-INDUCED OXIDATIVE DAMAGES IN WHEAT SEEDLING http://www.scopemed.org/?mno=186641 2015-04-26T04-31-14Z
Source: THE EGYPTIAN JOURNAL OF EXPERIMENTAL BIOLOGY (Botany)
Ghada Saber Mohamed Ismail.
The role of exogenous cysteine (cys) and hydrogen sulfide (supplied as sodium hydrosulfide, NaHS) in the amelioration of Ni toxicity in wheat plants was evaluated in a hydroponic culture system. Exposure of wheat plants to 100 and 200 μM Ni inhibited biomass production, decreased chlorophyll concentration and intensively increased accumulation of Ni in both roots and leaves. Concomitantly, Ni enhanced H2O2 formation, lipid peroxidation (as indicated by malondialdehyde (MDA) accumulation) and the activities of superoxide dismutase (SOD), catalase (CAT), ascorbate peroxidase (APX), guaiacol peroxidase (GPX) and glutathione reductase (GR) while it decreased the contents of cellular ascorbate and glutathione. Exogenous application of 2 mM NaHS and 50 µM cys separately to Ni solution significantly improved wheat growth but had a slight effect on the reversal of chlorophyll loss caused by Ni stress. NaHS significantly decreased the Ni accumulation in both studied wheat organs whereas cys has a slight effect. Application of NaHS and cys alleviated the oxidative damages as evidenced by the lowered hydrogen peroxide (H2O2) and malondialdhyde (MDA) contents. Exogenous sulpher, particularly NaHS, induced increases in the activities of CAT and GPX and the contents of cellular ascorbate and glutathione which was accompanied by a significant reduction in SOD, APX and GR activities in the in both wheat organs. These results reveal the potentiating effect of NaHS and cys in regulating Ni- induced oxidative stress in wheat plants.
]]>
Sat, 25 Apr 2015 12:09:57 GMT -08:00 http://www.scopemed.org/?mno=186641
MOLECULAR CHARACTERIZATION OF AZOLE-SUSCEPTIBLE AND RESISTANT CANDIDA ALBICANS ISOLATED FROM CANCER PATIENTS http://www.scopemed.org/?mno=186640 2015-04-26T04-31-14Z
Source: THE EGYPTIAN JOURNAL OF EXPERIMENTAL BIOLOGY (Botany)
Ahmed Medhat Hanafy.
In the present study, the genotypic characterizations of fluconazole and itraconazole (antifungal agents) susceptible and resistant C. albicans isolates were investigated. Thirteen C. albicans isolates were genotypically characterized using both restriction fragment length polymorphism (RFLP) and random amplified polymorphic DNA-polymerase chain reaction (RAPD-PCR) methods. Hinf I restriction fragments revealed an obvious polymorphism among the samples yielding five different types of patterns for the C. albicans isolates. Pattern 1 contained C. albicans ATCC 90029 reference strain along with all the five fluconazole/itraconazole susceptible isolates and the two fluconazole susceptible/itraconazole resistant isolates, patterns 2, 3, and 4 each contained a single isolate of the fluconazole/itraconazole resistant C. albicans, and pattern 5 contained the remaining two fluconazole/itraconazole resistant isolates. The RAPD-PCR method on the other hand followed by phylogenetic analysis of the resulting patterns identified the formation of two original clonal type groups (A and B). In group A, C. albicans ATCC 90029 along with all five fluconazole/itraconazole susceptible isolates were further clustered into three subgroups (genotypes), and in group B, two fluconazole susceptible/itraconazole resistant and the remaining five fluconazole/itraconazole resistant isolates were further clustered into five subgroups (genotypes). In relation to RAPD-PCR analysis, most azole susceptible isolates were classified into group A and resistant isolates in group B demonstrating that azole drugs may affect the genotypic behaviour of C. albicans depending on their susceptibility to these drugs.
]]>
Sat, 25 Apr 2015 12:07:59 GMT -08:00 http://www.scopemed.org/?mno=186640
PALYNOFLORA OF MIDDLE CRETACEOUS (ALBIAN-CENOMANIAN) IN GHORAB -1 BOREHOLE, NORTH WESTERN DESERT OF EGYPT http://www.scopemed.org/?mno=186639 2015-04-26T04-31-14Z
Source: THE EGYPTIAN JOURNAL OF EXPERIMENTAL BIOLOGY (Botany)
Gamal Mahmoud Abu-Sabaa Lashin Ied I. Mohamed.
Palynostratigraphic studies on the Cretaceous subsurface sediment of Ghorab-1 well from the northern part of the Western Desert have been investigated. Palynoflora are found to be derived principally from Pteridophyte spores (vascular land plants, 10 species), Gymnosperm pollen grains (13 species), Angiosperm pollen grains (14 species) and rare contribution of aquatic palynomorphs (9 taxa). The Palynoflora showed that the palaeoenvironments were favorable for different plant groups. The recovered microflora, therefore, indicated that the age nearly to Late-Albian (Kharita Formation) -Early Cenomanian (Bahariya Formation).Two distinct assemblage zones have been distinguished (I: Elaterosporites klaszii, Afropollis operculatus and II: Elaterocolpites castelainii, Cretacaeiporites polygonalis). The palynological data e.g. Elaterosporites klaszii, Afropollis operculatus, Cicatricosisporites minutistriatus, Perotriletes pannuceus and Elaterocolpites castelainii, Cretacaeiporites spp. proved also that the north Western Desert of Egypt belongs to the North Gondwana phytogeoprovince during the Cretaceous time.
]]>
Sat, 25 Apr 2015 12:06:04 GMT -08:00 http://www.scopemed.org/?mno=186639
STUDY THE EXPRESSION OF CHANNELRHODOPSIN-2 AS A DIRECTLY LIGHT-GATED CATION-SELECTIVE MEMBRANE CHANNEL IN HEK 293 CELLS http://www.scopemed.org/?mno=186638 2015-04-26T04-31-14Z
Source: THE EGYPTIAN JOURNAL OF EXPERIMENTAL BIOLOGY (Botany)
Ahmed El-Hussein Mohamed Kamel.
Channelrhodopsins (ChRs) originated from Chlamydomonas genus has been considered as directly light-gated ion channels. In microalgae, their primary function is to direct the organism towards or away from the light stimulus as well to optimize the light conditions needed for photosynthesis. ChR2 originated from Chlamydomonas reinhardtii involved in generation of photocurrents in this green alga has been found to be 10 times better than ChR1 for the expression in most host cells like Xenopus oocytes. Despite of this fact and ChR2 can be easily targeted genetically; many of selective promoters cannot achieve sufficient expression levels of ChR2 for photostimulation. In the present work, Chop2T159C mCherry plasmid has been expressed in HEK 293 cells in one set of experiments, where cotransfection of Chop2T159C plasmid and mCherry plasmid in another set of experiments. The results have shown that ChR2 is a directly light-switched cation-selective ion channel upon stimulating the cells with 475 nm blue light. This channel opens rapidly after absorption of a photon to generate a large permeability for monovalent and divalent cations. Furthermore the degree of expression of Chop2T159C mCherry plasmid in HEK 293 cells was better than that of Chop2T159C alone based on the resulted current in response of the incident light despite the initial thought of being mCherry genes would compete with the Chop2T159C genes.
]]>
Sat, 25 Apr 2015 12:03:45 GMT -08:00 http://www.scopemed.org/?mno=186638
ANTIFUNGAL ACTIVITIES OF METHANOLIC EXTRACTS OF SOME MARINE ALGAE (ULVACEAE AND DICTYOTACEAE) OF BENGHAZI COASTS, LIBYA http://www.scopemed.org/?mno=186637 2015-04-26T04-31-14Z
Source: THE EGYPTIAN JOURNAL OF EXPERIMENTAL BIOLOGY (Botany)
El-Fatimi A. Soliman El-Gahmi H. Ali Godeh M. Masoud Bleibilo A. Mohamed Said A. Abd El-Moneim.
Crude methanolic extracts of 10 Marine algae (6 Ulvaceae and 4 Dictyotaceae) of Benghazi coasts collected during different seasons were tested in vitro for their antifungal activities against 5 fungi. Statistical data highlighted significant differences of antifungal activities between algal species with special reference to Dictyotaceae. Extracts of Dictyota linearis and Dictyota dichotoma were relatively more effective (25.36 and 23.82 mm, respectively) against the tested fungi, while extracts of Ulva lactuca was relatively low (16.13 mm). Statistically, the interaction between algal and fungal types didn't affect the activities of methanolic algal extracts. Aspergillus flavus was the relatively resistant fungus (17.01 mm) while, Penicellium sp. was the relatively sensitive one (22.42 mm). All tested fungi were significantly affected by season's difference with special reference to spring and summer.
]]>
Sat, 25 Apr 2015 12:01:48 GMT -08:00 http://www.scopemed.org/?mno=186637
EPIDEMIOLOGY OF HUMAN MYCOTIC KERATITIS IN TANTA UNIVERSITY OPHTHALMOLOGY HOSPITAL http://www.scopemed.org/?mno=186636 2015-04-26T04-31-14Z
Source: THE EGYPTIAN JOURNAL OF EXPERIMENTAL BIOLOGY (Botany)
Abu El-Souod S. Mohamed Mahmoud Y. A. Galele El-Shourbagy M. Sameh El-Badry A. S. Mohamed.
The target of the present study was to evaluate the spreading mycotic infection of human corneal ulcers on the basis of the predisposing factors. Contact lens users and farmers were found to be more susceptible for mycotic keratitis; also immunocompromised male patients aged more than 40 years with rural residence were the most frequent inhabitants of fungal corneal ulcers, during summer, and spring seasons. Aspergillus flavus, and Aspergillus niger were the most common species, isolated from the studied mycotic keratitis cases, mostly causing central corneal lesions in right more than left eyes. On the other hand, out of 595 cases of different types of corneal ulcers, fungi were isolated from 50 cases.
]]>
Sat, 25 Apr 2015 11:59:31 GMT -08:00 http://www.scopemed.org/?mno=186636
CLONING AND EXPRESSION OF BOVINE SOMATOTROPIN GROWTH HORMONE GENE FROM LOCAL COWS BREEDS OF BASRAH CITY, IRAQ http://www.scopemed.org/?mno=186635 2015-04-26T04-31-14Z
Source: THE EGYPTIAN JOURNAL OF EXPERIMENTAL BIOLOGY (Botany)
Mohamad A. Maarich AL-hajaj Othman R. Monther.
The present study, have undertaken the cloning of bovine growth hormone or bovine somatotropin gene from local cows breed in Basrah city, and optimizing the conditions for its high-level expression in Escherichia coli. To achieve this goal the cDNA for bovine growth hormone was inserted in to the Pst1 site of pBR322 via the poly dC: poly dG joining technique to produce the recombinant vector. The cloning vector was then transformed into E. coli HB101. The efficiency of transformation also determined to be 2 × 107 cfu/µg. The fermentation strategy for high cells density growth of E. coli harboring the bGH gene was carried out and the highest cells density level was determined to be 1.540 ¬¬¬at OD600 after 8 hs of cells growing. Following solubilization and refolding, bovine growth hormone was purified by using ion exchange chromatography and the result was a single visible band with 22KDa on 12% SDS-Polyachrylamid gel which represents the purified bGH.
]]>
Sat, 25 Apr 2015 11:56:31 GMT -08:00 http://www.scopemed.org/?mno=186635