Home|Journals Follow on Twitter| Subscribe to List

Directory for Medical Articles

Open Access


Egypt. J. Exp. Biol. (Bot.). 2012; 8(1): 87-92


Mahmoud A. Ismail.

Pseudoazurin (PAz) is a blue copper protein that functions as an electron carrier in numerous microorganisms. In several denitrifying bacteria PAz serves as the electron donor to nitrite reductase (NiR) in the anaerobic respiration system. Achromobacter cycloclastes IAM 1013 was grown at 30C in LB medium and genomic DNA was isolated (using the GENOME kit from BIOgene). The genomic DNA was used as a template in polymerase chain reactions (PCR) in which the PAz gene was amplified using the following two primers: ccatggtgaatgcaatcaagag (forward primer) and ccatggctagaagtcgcttagt (reverse primer). The primer sequences were based on the DNA sequence of Achromobacter cycloclastes IAM 1013 PAz and were designed in such a way to include the signal sequence for the protein. The amplified fragment was cloned into PET 15b vector which digested with Nco1.Polyacrylamide gel electrophoresis was used to characterize the extracted protein

Key words: Cloning, Expression, Pseudoazurin, Gene; Protein

Share this Article

American Journal of Research in Medical Sciences


ScopeMed Home
Follow ScopeMed on Twitter
Author Tools
eJPort Journal Hosting
About ScopeMed
License Information
Terms & Conditions
Privacy Policy
Suggest a Journal
Publisher Login
Contact Us

The articles in Scopemed are open access articles licensed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International License (https://creativecommons.org/licenses/by-nc-sa/4.0/) which permits unrestricted, non-commercial use, distribution and reproduction in any medium, provided the work is properly cited.
ScopeMed is a Database Service for Scientific Publications. Copyright ScopeMed Information Services.
Scopemed Buttons